pSCALPS-FLAG-HA-mmuMettl3-LN
(Plasmid
#207129)
-
PurposeLentiviral plasmid to express mouse Mettl3 Lambda peptide C-ter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207129 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSCALPS
- Backbone size w/o insert (bp) 7740
- Total vector size (bp) 9559
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMettl3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1765
-
GenBank IDNM_019721.2
-
Entrez GeneMettl3 (a.k.a. 2310024F18Rik, M6A, Spo8)
- Promoter SSFV
-
Tags
/ Fusion Proteins
- FLAG-HA (N terminal on insert)
- Lambda Peptide (LN) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCCACCATGGACTACAAGGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSCALPS-FLAG-HA-mmuMettl3-LN was a gift from Silvia Monticelli (Addgene plasmid # 207129 ; http://n2t.net/addgene:207129 ; RRID:Addgene_207129) -
For your References section:
The mRNA methyltransferase Mettl3 modulates cytokine mRNA stability and limits functional responses in mast cells. Leoni C, Bataclan M, Ito-Kureha T, Heissmeyer V, Monticelli S. Nat Commun. 2023 Jun 29;14(1):3862. doi: 10.1038/s41467-023-39614-y. 10.1038/s41467-023-39614-y PubMed 37386028