Skip to main content
Addgene

pET23A-Fucosidase-E1_10125-Ruminococcus_gnavus-His
(Plasmid #207665)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207665 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PET23A
  • Backbone manufacturer
    Merck Millipore Novagen
  • Backbone size w/o insert (bp) 3605
  • Total vector size (bp) 5252
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For production of DNA, use JM109. For expression of the fucosidase, use BL21. Grow at 37 degrees Celsius until OD 0.8-1.0, induce with IPTG, then grow at room temperature.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Fucosidase E1_10125
  • Species
    Ruminococcus gnavus
  • Insert Size (bp)
    1647
  • Mutation
    amino acids 34-584 were used
  • GenBank ID
    WP_268803839.1
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • His-tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer T7 Fwd TAATACGACTCACTATAGGG
  • 3′ sequencing primer GATATAGTTCCTCCTTTCAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.12.15.571923 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET23A-Fucosidase-E1_10125-Ruminococcus_gnavus-His was a gift from Robert de Vries (Addgene plasmid # 207665 ; http://n2t.net/addgene:207665 ; RRID:Addgene_207665)
  • For your References section:

    H7 influenza A viruses bind sialyl-LewisX, a potential intermediate receptor between species. Spruit C, Palme DI, Li T, Ríos Carrasco M, Gabarroca García A, Sweet I, Kuryshko M, Maliepaard JCL, Reiding KR, Scheibner D, Boons G-J, Abdelwhab EM, de Vries RP. bioRxiv 2023.12.15.571923 10.1101/2023.12.15.571923