qTAG-C-miRFP670nano3-Blast-H2BC11
(Plasmid
#207762)
-
PurposeDonor template for miRFP670nano3-2A-Blast insertion into the C-terminus of the H2BC11 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 Addgene #207755
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207762 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2686
-
Vector typeMammalian Expression, CRISPR ; Donor Template
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH2BC11 Homology Arms flanking a miRFP670nano3-Blast Cassette
-
Alt nameH2BC11
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2208
-
Entrez GeneH2BC11 (a.k.a. H2B/r, H2BFR, H2BJ, HIST1H2BJ)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CTGCAAGGCGATTAAGTTGGGTAAC
- 3′ sequencing primer GGCTCGTATGTTGTGTGGAATTGT (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 https://www.addgene.org/207755 .
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
qTAG-C-miRFP670nano3-Blast-H2BC11 was a gift from Laurence Pelletier (Addgene plasmid # 207762 ; http://n2t.net/addgene:207762 ; RRID:Addgene_207762) -
For your References section:
qTAG: An adaptable CRISPR-based endogenous tagging protocol using optimized repair cassettes. Philip R, Sharma A, Matellan L, Erpf AC, Hsu W, Tkach JM, Wyatt HDM, Pelletier L. bioRxiv 10.1101/2023.11.01.565029