Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti-Cas9-NS-A
(Plasmid #207823)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 207823 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLenti-Cas9
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    non-specific sgRNA
  • gRNA/shRNA sequence
    GTGTCGTGATGCGTAGACGG
  • Species
    H. sapiens (human)
  • Promoter EF-1a; U6
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-Cas9-NS-A was a gift from Ben Major (Addgene plasmid # 207823 ; http://n2t.net/addgene:207823 ; RRID:Addgene_207823)
  • For your References section:

    Proximity proteomic analysis of the NRF family reveals the Parkinson's disease protein ZNF746/PARIS as a co-complexed repressor of NRF2. LaPak KM, Saeidi S, Bok I, Wamsley NT, Plutzer IB, Bhatt DP, Luo J, Ashrafi G, Ben Major M. Sci Signal. 2023 Dec 12;16(815):eadi9018. doi: 10.1126/scisignal.adi9018. Epub 2023 Dec 12. 10.1126/scisignal.adi9018 PubMed 38085818