pLV_PGK_3xHA-LTB4R(S310A)
(Plasmid #208093)

• Purpose: Mammalian expression of the human LTB4 receptor LTB4R with the S310A mutation with an N-terminal 3x HA tag.
• Depositing Lab: Sean R Collins
• Publication: Lundgren et al Sci Signal. 2023 Oct 3;16(805):eadd1845. doi: 10.1126/scisignal.add1845. Epub 2023 Oct 3.

Backbone

• Vector backbone: pLenti 2nd gen
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: 3xHA-LTB4R(S310A)
• Alt name: LTB4R
• Species: H. sapiens (human)
• Insert Size (bp): 1140
• Mutation: S310A
• Entrez Gene: LTB4R (a.k.a. BLT1, BLTR, CMKRL1, GPR16, LTB4R1, LTBR1, P2RY7, P2Y7)
• Promoter: PGK
• Tag / Fusion Protein:
  • 3xHA (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tgttccgcattctgcaagc
• 3′ sequencing primer: cctcacattgccaaaagacg

Resource Information

• Supplemental Documents:
  • pLV_PGK_3xHA-LTB4R(S310A).gb
• A portion of this plasmid was derived from a plasmid made by: The wild-type LTB4R sequence was obtained from the Harvard plasmid repository (plasmid #HsCD00003892)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

5' Cloning Site: BamHI (not destroyed); 3' Cloning Site: NotI (not destroyed)