1529_pAAV-CB-FKBP12-BirA-HA
(Plasmid #208200)

• Purpose: Express the murine FKBP12-BirA-HA fusion protein in AAV vector
• Depositing Lab: Susan Hamilton
• Publication: Lee et al Commun Biol. 2023 Sep 14;6(1):942. doi: 10.1038/s42003-023-05330-y.

Backbone

• Vector backbone: pEMBL8
• Backbone size w/o insert (bp): 5769
• Total vector size (bp): 6093
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Confirm ITRs after propagation by restriction digest with XmaI, sequencing
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Fkbp12
• Species: M. musculus (mouse)
• Entrez Gene: Fkbp1a (a.k.a. FKBP12, Fkbp, Fkbp1)
• Promoter: Chicken beta-actin

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (unknown if destroyed)
• 3′ cloning site: HindIII (unknown if destroyed)
• 5′ sequencing primer: gctcctcagtggatgttgcctttac

Resource Information

• Supplemental Documents:
  • 1529_pAAV-CB-FKBP12-BirA-HA.gbk
• A portion of this plasmid was derived from a plasmid made by: Dr. Pumin Zhang created the targeting vectors. Dr. Jin Hong synthesized and cloned the plasmid.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry