1529_pAAV-CB-FKBP12-BirA-HA
(Plasmid
#208200)
-
PurposeExpress the murine FKBP12-BirA-HA fusion protein in AAV vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208200 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEMBL8
- Backbone size w/o insert (bp) 5769
- Total vector size (bp) 6093
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsConfirm ITRs after propagation by restriction digest with XmaI, sequencing
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFkbp12
-
SpeciesM. musculus (mouse)
-
Entrez GeneFkbp1a (a.k.a. FKBP12, Fkbp, Fkbp1)
- Promoter Chicken beta-actin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer gctcctcagtggatgttgcctttac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDr. Pumin Zhang created the targeting vectors. Dr. Jin Hong synthesized and cloned the plasmid.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
1529_pAAV-CB-FKBP12-BirA-HA was a gift from Susan Hamilton (Addgene plasmid # 208200 ; http://n2t.net/addgene:208200 ; RRID:Addgene_208200) -
For your References section:
Speg interactions that regulate the stability of excitation-contraction coupling protein complexes in triads and dyads. Lee CS, Jung SY, Yee RSZ, Agha NH, Hong J, Chang T, Babcock LW, Fleischman JD, Clayton B, Hanna AD, Ward CS, Lanza D, Hurley AE, Zhang P, Wehrens XHT, Lagor WR, Rodney GG, Hamilton SL. Commun Biol. 2023 Sep 14;6(1):942. doi: 10.1038/s42003-023-05330-y. 10.1038/s42003-023-05330-y PubMed 37709832