pAAV-C2-mKate
(Plasmid
#208792)
-
PurposeFor AAV production to express C2-mKate in astrocytes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208792 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-GFAP-mKate2.5f
-
Backbone manufacturerViviana Gradinaru
- Backbone size w/o insert (bp) 4496
- Total vector size (bp) 5852
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameC2-mKate
-
Alt nameC2 domain
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1356
-
GenBank ID17304
-
Entrez GeneMfge8 (a.k.a. MFG-E8, MP47, Mfgm, P47, SED1, lactadherin)
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- mKate (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AflII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GAAGGTCTGAAGAGTTTACTCC
- 3′ sequencing primer AATGAAAGCCATACGGGAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: The plasmid contains a 22bp deletion in the 5' ITR. The plasmid was successfully used for AAV packaging and expression in cells and tissues by the depositing lab. These discrepancies are not expected to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-C2-mKate was a gift from Urte Neniskyte (Addgene plasmid # 208792 ; http://n2t.net/addgene:208792 ; RRID:Addgene_208792) -
For your References section:
Genetically encoded phosphatidylserine biosensor for in vitro, ex vivo and in vivo labelling. Dirvelyte E, Bujanauskiene D, Jankaityte E, Daugelaviciene N, Kisieliute U, Nagula I, Budvytyte R, Neniskyte U. Cell Mol Biol Lett. 2023 Jul 27;28(1):59. doi: 10.1186/s11658-023-00472-7. 10.1186/s11658-023-00472-7 PubMed 37501184