Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-CMV-FLEX-SaCas9-U6-sgKcnma1
(Plasmid #209199)

Print

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 209199 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-FLEX-SaCas9-U6-sgRNA
  • Backbone manufacturer
    Larry Zweifel (Addgene plasmid # 124844)
  • Vector type
    Mouse Targeting, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kcnma1
  • gRNA/shRNA sequence
    GTCTAGGCTGAGATGGTTCGC
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Kcnma1 (a.k.a. 5730414M22Rik, BKCA alpha, BKCa, KCa1.1, MaxiK, Slo, Slo1, k(VCA)alpha, mSlo, mSlo1, slo-alpha)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CMV-FLEX-SaCas9-U6-sgKcnma1 was a gift from Larry Zweifel (Addgene plasmid # 209199 ; http://n2t.net/addgene:209199 ; RRID:Addgene_209199)

  • For your References section:

    Temporal scaling of dopamine neuron firing and dopamine release by distinct ion channels shape behavior. Juarez B, Kong MS, Jo YS, Elum JE, Yee JX, Ng-Evans S, Cline M, Hunker AC, Quinlan MA, Baird MA, Elerding AJ, Johnson M, Ban D, Mendez A, Goodwin NL, Soden ME, Zweifel LS. Sci Adv. 2023 Aug 11;9(32):eadg8869. doi: 10.1126/sciadv.adg8869. Epub 2023 Aug 11. 10.1126/sciadv.adg8869 PubMed 37566654
Related items: