pBJ077_zACNE20_E1b_2xLyn_mCherry
(Plasmid
#209281)
-
PurposeExpresses membrane-labelled mCherry in the zebrafish heart
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209281 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonezACNE20_E1b
- Backbone size w/o insert (bp) 7671
- Total vector size (bp) 8511
-
Vector typeZebrafish Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry2
-
SpeciesSynthetic
-
Insert Size (bp)840
- Promoter zACNE20_E1b
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gctaaccatgttcatgcctt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBJ077_zACNE20_E1b_2xLyn_mCherry was a gift from Adam Cohen (Addgene plasmid # 209281 ; http://n2t.net/addgene:209281 ; RRID:Addgene_209281) -
For your References section:
A bioelectrical phase transition patterns the first vertebrate heartbeats. Jia BZ, Qi Y, Wong-Campos JD, Megason SG, Cohen AE. Nature. 2023 Oct;622(7981):149-155. doi: 10.1038/s41586-023-06561-z. Epub 2023 Sep 27. 10.1038/s41586-023-06561-z PubMed 37758945