CibN
(Plasmid
#209671)
-
PurposeExpresses CIB1 fused with Split-TurboID-N and pmGFP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209671 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCMV-pmEGFP
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 6100
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCIB1
-
Alt nameCIB1
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)1000
-
GenBank IDBT005313
-
Entrez GeneCIB1 (a.k.a. AT4G34530, T4L20.110, T4L20_110, cryptochrome-interacting basic-helix-loop-helix 1)
- Promoter CMV
-
Tags
/ Fusion Proteins
- Split-TurboID-N (C terminal on insert)
- pmEGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site SacII (unknown if destroyed)
- 5′ sequencing primer gcaaatgggcggtaggcgtg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byCIB1 originally cloned by C. Tucker. sTurboID (N) originally cloned by A. Ting.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CibN was a gift from Sanjeevi Sivasankar (Addgene plasmid # 209671 ; http://n2t.net/addgene:209671 ; RRID:Addgene_209671) -
For your References section:
Light-activated BioID - an optically activated proximity labeling system to study protein-protein interactions. Shafraz O, Davis CMO, Sivasankar S. J Cell Sci. 2023 Oct 1;136(19):jcs261430. doi: 10.1242/jcs.261430. Epub 2023 Oct 11. 10.1242/jcs.261430 PubMed 37756605