Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-hsyn-dMASS_LF_WPRE
(Plasmid #209766)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 209766 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV
  • Total vector size (bp) 6481
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dMASS_LF
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1967
  • GenBank ID
    NM_000794
  • Promoter hSyn

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer atgaagacgatcatcgccctgagc
  • 3′ sequencing primer aagcttatcgataatcaacctctgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hsyn-dMASS_LF_WPRE was a gift from Andre Berndt (Addgene plasmid # 209766 ; http://n2t.net/addgene:209766 ; RRID:Addgene_209766)
  • For your References section:

    Optogenetic Microwell Array Screening System: A High-Throughput Engineering Platform for Genetically Encoded Fluorescent Indicators. Rappleye M, Wait SJ, Lee JD, Siebart JC, Torp L, Smith N, Muster J, Matreyek KA, Fowler DM, Berndt A. ACS Sens. 2023 Nov 24;8(11):4233-4244. doi: 10.1021/acssensors.3c01573. Epub 2023 Nov 13. 10.1021/acssensors.3c01573 PubMed 37956352