Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

px552-U6-gRNA1-CMV-eGFP
(Plasmid #211758)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 211758 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    px552
  • Backbone manufacturer
    (Addgene #60958)
  • Modifications to backbone
    Replaced the human synapsin (hSyn) promotor with a ubiquitous CMV promotor to drive GFP expression
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA1 targeting VEGF-A
  • gRNA/shRNA sequence
    CAGAAAGTTCATGGTTTCGG
  • Species
    H. sapiens (human), M. musculus (mouse); M. mulatta (rhesus macaque)
  • GenBank ID
    ENSMMUG00000004577
  • Entrez Gene
    VEGFA (a.k.a. L-VEGF, MVCD1, VEGF, VPF)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SapI (unknown if destroyed)
  • 3′ cloning site SapI (unknown if destroyed)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px552-U6-gRNA1-CMV-eGFP was a gift from Glenn Yiu (Addgene plasmid # 211758 ; http://n2t.net/addgene:211758 ; RRID:Addgene_211758)