pKT-CNP
(Plasmid #211803)

• Purpose: Expresses 2',3'-cyclic nucleotide phosphodiesterase catalytic domain
• Depositing Lab: Emily Weinert
• Publication: Fontaine et al Biochem J. 2018 Apr 30;475(8):1491-1506. doi: 10.1042/BCJ20170906.

Backbone

• Vector backbone: pKT
• Backbone size w/o insert (bp): 3641
• Total vector size (bp): 4298
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: 2',3'-cyclic nucleotide phosphodiesterase catalytic domain
• Alt name: CNP
• Species: R. norvegicus (rat)
• Insert Size (bp): 660
• Entrez Gene: Cnp (a.k.a. CNPF, CNPI, CNPII, Cnp1)
• Promoter: tet

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: ACCACTCCCTATCAGTGATA
• 3′ sequencing primer: GTAAAACGACGGCCAGT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry