Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAC150-KEIMA-VAPA
(Plasmid #212096)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 212096 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAC150-PBLHL-4xHS-EF1a-DEST
  • Backbone manufacturer
    Addgene Plasmid #48234
  • Vector type
    Mammalian Expression ; PiggyBac
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    VAPA
  • Alt name
    VAMP-A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    883
  • GenBank ID
    NM_003574.6
  • Entrez Gene
    VAPA (a.k.a. VAMP-A, VAP-33, VAP-A, VAP33, hVAP-33)
  • Promoter EF1a
  • Tag / Fusion Protein
    • mKeima (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAC150-KEIMA-VAPA was a gift from Wade Harper (Addgene plasmid # 212096 ; http://n2t.net/addgene:212096 ; RRID:Addgene_212096)
  • For your References section:

    Combinatorial selective ER-phagy remodels the ER during neurogenesis. Hoyer MJ, Capitanio C, Smith IR, Paoli JC, Bieber A, Jiang Y, Paulo JA, Gonzalez-Lozano MA, Baumeister W, Wilfling F, Schulman BA, Harper JW. Nat Cell Biol. 2024 Mar;26(3):378-392. doi: 10.1038/s41556-024-01356-4. Epub 2024 Mar 1. 10.1038/s41556-024-01356-4 PubMed 38429475