pSH83
(Plasmid
#212989)
-
Purposeexpresses miniSOG in C. elegans
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 212989 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSH11
- Backbone size w/o insert (bp) 5429
- Total vector size (bp) 7297
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameflp-13 promoter
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)2296
-
Entrez Geneflp-13 (a.k.a. CELE_F33D4.3)
- Promoter flp-13
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TTGGGCTGCAgcatgAAATTGTGCCTCCTGATGCTGAATCCT
- 3′ sequencing primer CTCTAGAGGCGCGCCGTTCGAATCGGAACGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloning Method: In-Fusion cloning
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSH83 was a gift from David M. Miller (Addgene plasmid # 212989 ; http://n2t.net/addgene:212989 ; RRID:Addgene_212989) -
For your References section:
C. elegans neurons have functional dendritic spines. Cuentas-Condori A, Mulcahy B, He S, Palumbos S, Zhen M, Miller DM 3rd. Elife. 2019 Oct 4;8. pii: 47918. doi: 10.7554/eLife.47918. 10.7554/eLife.47918 PubMed 31584430