CIRTS-Gas5
(Plasmid #213172)

• Purpose: CIRTS RNA targeting system for targeted knockdown in neurons. CIRTS-Calm3 and Gas5 guide RNA is expressed under human Syn1 and U6 promoter, respectively.
• Depositing Lab: Timothy Bredy
• Publication: Liau et al Nat Commun. 2023 Nov 22;14(1):7616. doi: 10.1038/s41467-023-43535-1.

Backbone

• Vector backbone: pFsy(1.1)GW
• Backbone manufacturer: Addgene
• Backbone size w/o insert (bp): 9801
• Total vector size (bp): 12593
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CIRTS-Calm3-U6-Gas5 gRNA
• Species: Synthetic
• Insert Size (bp): 3531
• Promoter: Syn1, U6
• Tag / Fusion Protein:
  • GFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: Syn1 Forward CCACAAGAGGTGCAAGATAGG
• 3′ sequencing primer: WPRE-R CATAGCGTAAAAGGAGCAACA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The original CIRTS PIN nuclease is obtained from Bryan Dickinson Lab

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry