CIRTS-control
(Plasmid
#213788)
-
PurposeCIRTS RNA targeting system for targeted knockdown in neurons. CIRTS-Calm3 and scramble control guide RNA is expressed under human Syn1 and U6 promoter, respectively.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213788 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFsy(1.1)GW
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 9801
- Total vector size (bp) 12376
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCIRTS-Calm3-U6-control gRNA
-
SpeciesSynthetic
-
Insert Size (bp)3314
- Promoter Syn1, U6
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer Syn1 Forward CCACAAGAGGTGCAAGATAGG
- 3′ sequencing primer WPRE-R CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe original CIRTS PIN nuclease is obtained from Bryan Dickinson Lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CIRTS-control was a gift from Timothy Bredy (Addgene plasmid # 213788 ; http://n2t.net/addgene:213788 ; RRID:Addgene_213788) -
For your References section:
Fear extinction is regulated by the activity of long noncoding RNAs at the synapse. Liau WS, Zhao Q, Bademosi A, Gormal RS, Gong H, Marshall PR, Periyakaruppiah A, Madugalle SU, Zajaczkowski EL, Leighton LJ, Ren H, Musgrove M, Davies J, Rauch S, He C, Dickinson BC, Li X, Wei W, Meunier FA, Fernandez-Moya SM, Kiebler MA, Srinivasan B, Banerjee S, Clark M, Spitale RC, Bredy TW. Nat Commun. 2023 Nov 22;14(1):7616. doi: 10.1038/s41467-023-43535-1. 10.1038/s41467-023-43535-1 PubMed 37993455