Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

KIF5A-GFP-SspB
(Plasmid #214401)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 214401 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFPN1
  • Backbone size w/o insert (bp) 4733
  • Total vector size (bp) 6790
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    KIF5A-GFP-SspB
  • Alt name
    Kif5a
  • Species
    R. norvegicus (rat), Synthetic
  • Insert Size (bp)
    2844
  • Entrez Gene
    Kif5a
  • Promoter CMV
  • Tag / Fusion Protein
    • KIF5A-GFP-SspB (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CMV Forward
  • 3′ sequencing primer CCTCTACAAATGTGGTATGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    KIF5A-GFP-SspB was a gift from Liting Duan (Addgene plasmid # 214401 ; http://n2t.net/addgene:214401 ; RRID:Addgene_214401)
  • For your References section:

    Force-induced tail-autotomy mitochondrial fission and biogenesis of matrix-excluded mitochondrial-derived vesicles for quality control. Liu X, Xu L, Song Y, Zhao Z, Li X, Wong CY, Chen R, Feng J, Gou Y, Qi Y, Chow HM, Yao S, Wang Y, Gao S, Liu X, Duan L. Proc Natl Acad Sci U S A. 2024 Apr 2;121(14):e2217019121. doi: 10.1073/pnas.2217019121. Epub 2024 Mar 28. 10.1073/pnas.2217019121 PubMed 38547062