MCAM-GFP
(Plasmid
#214475)
-
PurposeLentiviral vector for the expression of MCAM-GFP fusion protein in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 214475 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCSII-Rfa-IRES-Hygro Lentiviral Dest
-
Backbone manufacturerXuedong Liu, University of Colorado Boulder
- Backbone size w/o insert (bp) 12467
- Total vector size (bp) 13588
-
Vector typeMammalian Expression, Lentiviral ; Gateway
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMCAM
-
Alt nameMelanoma Cell Adhesion Molecule
-
Alt nameCD146
-
Alt nameMuc18
-
SpeciesH. sapiens (human)
- Promoter EF-1a
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer ACTTTGTACAAGAAAGCTGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byCCSB-Boad Lentiviral Expression Library plasmid ccsbBroad304_06567, from the Functional Genomics facility, University of Colorado Anschutz Medical Campus, Denver, CO.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Detailed information on cloning, including cloning of entry vector, cloning and internal sequencing primers, and entry vector sequences are available in the supplemental materials for Miller et al. EGFP DNA was a gift from Amy Palmer, University of Colorado Boulder.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MCAM-GFP was a gift from Natalie Ahn (Addgene plasmid # 214475 ; http://n2t.net/addgene:214475 ; RRID:Addgene_214475) -
For your References section:
Cooperative polarization of MCAM/CD146 and ERM family proteins in melanoma. Miller SG, Hoh M, Ebmeier CC, Tay JW, Ahn NG. Mol Biol Cell. 2023 Dec 20:mbcE23060255. doi: 10.1091/mbc.E23-06-0255. 10.1091/mbc.E23-06-0255 PubMed 38117590