-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21484 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneJP027/CAG
- Backbone size w/o insert (bp) 5868
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChannel Rhodopsin 2 EGFP Myosin Binding Domain
-
Alt nameCHR2-MBD
-
Alt nameChannel Rhodopsin 2
-
Alt nameMelanophilin
-
SpeciesMixture
-
Insert Size (bp)1801
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe1 (not destroyed)
- 3′ cloning site Nsi1 (not destroyed)
- 5′ sequencing primer gcaacgtgctggttgttgtgc (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
ChR2-MBD was constructed by inserting the sequence encoding Melanophilin amino acids 176–201 downstream of the Venus gene in the CAG-ChR2-Venus vector.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CHR2-MBD was a gift from Don Arnold (Addgene plasmid # 21484 ; http://n2t.net/addgene:21484 ; RRID:Addgene_21484) -
For your References section:
Myosin-dependent targeting of transmembrane proteins to neuronal dendrites. Lewis TL, Mao T, Svoboda K, Arnold DB. Nat Neurosci. 2009 May . 12(5):568-76. 10.1038/nn.2318 PubMed 19377470