This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

CHR2-MBD
(Plasmid #21484)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 21484 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Channel Rhodopsin 2 EGFP Myosin Binding Domain
  • Alt name
    CHR2-MBD
  • Alt name
    Channel Rhodopsin 2
  • Alt name
    Melanophilin
  • Species
    Mixture
  • Insert Size (bp)
    1801

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe1 (not destroyed)
  • 3′ cloning site Nsi1 (not destroyed)
  • 5′ sequencing primer gcaacgtgctggttgttgtgc
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

ChR2-MBD was constructed by inserting the sequence encoding Melanophilin amino acids 176–201 downstream of the Venus gene in the CAG-ChR2-Venus vector.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CHR2-MBD was a gift from Don Arnold (Addgene plasmid # 21484)
  • For your References section:

    Myosin-dependent targeting of transmembrane proteins to neuronal dendrites. Lewis TL, Mao T, Svoboda K, Arnold DB. Nat Neurosci. 2009 May . 12(5):568-76. 10.1038/nn.2318 PubMed 19377470