B2396_BTB-EGFP
(Plasmid
#215099)
-
PurposeExpresses BCL6 BTB(1-129)-EGFP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 215099 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneEGFPN1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBTB-EGFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1179
-
GenBank IDNM_001706.5
-
Entrez GeneBCL6 (a.k.a. BCL5, BCL6A, LAZ3, ZBTB27, ZNF51)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
B2396_BTB-EGFP was a gift from Chandra Tucker (Addgene plasmid # 215099 ; http://n2t.net/addgene:215099 ; RRID:Addgene_215099) -
For your References section:
A platform to induce and mature biomolecular condensates using chemicals and light. Hernandez-Candia CN, Brady BR, Harrison E, Tucker CL. Nat Chem Biol. 2024 Jan 8. doi: 10.1038/s41589-023-01520-1. 10.1038/s41589-023-01520-1 PubMed 38191942