pTOCK1
(Plasmid #215566)

• Purpose: Escherichia coli–Aspergillus spp. shuttle cosmid-based library system
• Depositing Lab: Takuji Oka
• Publication: Kadooka et al J Fungi (Basel). 2024 Feb 29;10(3):188. doi: 10.3390/jof10030188.

Backbone

• Vector backbone: SuperCos 1
• Backbone manufacturer: Agilent technologies
• Backbone size w/o insert (bp): 7937
• Total vector size (bp): 14937
• Vector type: Escherichia coli-Aspergillus spp. shuttle cosmid vector
• Selectable markers: AopyrG

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: AopyrG
• Species: Aspergillus oryzae
• Insert Size (bp): 1763

Cloning Information for Gene/Insert 1

• Cloning method: Other
• 5′ sequencing primer: GTCTCATGAGCGGATACATA

Gene/Insert 2

• Gene/Insert name: AMA1
• Species: Aspergillus nidulans
• Insert Size (bp): 5251

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (unknown if destroyed)
• 3′ cloning site: HindIII (unknown if destroyed)
• 5′ sequencing primer: TATTTATGCAGAGGCCGAGG

Gene/Insert 3

• Gene/Insert name: ampicillin resistance (bla) ORF
• Insert Size (bp): 861

Cloning Information for Gene/Insert 3

• Cloning method: Other
• 5′ sequencing primer: AAAGTCTGGAAACGCGGAAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry