Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p2710-pHAGE2-Ef1aL-wtYAP-UBC-tagBFP-loxP
(Plasmid #216479)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 216479 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHAGE2
  • Total vector size (bp) 9801
  • Vector type
    Lentiviral, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    wtYAP (YAP1)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1613
  • Entrez Gene
    YAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)
  • Promoter EF1aL

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site BamHI - BglII (destroyed during cloning)
  • 5′ sequencing primer gctagcggccgccATGGACTACAAAGACCATGACGGT
  • 3′ sequencing primer gcgcagatctTCACACCACTTTGTACAAGAAAGTTGGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    tagBFP
  • Species
    Synthetic
  • Insert Size (bp)
    702
  • Promoter UBC

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer aatccatatggccatgagcgagctgattaagg
  • 3′ sequencing primer acgaatccatatggccatgagcgagctgattaagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p2710-pHAGE2-Ef1aL-wtYAP-UBC-tagBFP-loxP was a gift from Darrell Kotton (Addgene plasmid # 216479 ; http://n2t.net/addgene:216479 ; RRID:Addgene_216479)
  • For your References section:

    Generation of human alveolar epithelial type I cells from pluripotent stem cells. Burgess CL, Huang J, Bawa PS, Alysandratos KD, Minakin K, Ayers LJ, Morley MP, Babu A, Villacorta-Martin C, Yampolskaya M, Hinds A, Thapa BR, Wang F, Matschulat A, Mehta P, Morrisey EE, Varelas X, Kotton DN. Cell Stem Cell. 2024 Apr 15:S1934-5909(24)00098-5. doi: 10.1016/j.stem.2024.03.017. 10.1016/j.stem.2024.03.017 PubMed 38642558