PX459-TP53-exon5
(Plasmid
#217456)
-
PurposeFor TP53 knockout targeting exon 5 of TP53
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 217456 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro (PX459) V2.0
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCRISPR Cas9 guide for TP53
-
gRNA/shRNA sequenceTATCTGAGCAGCGCTCATGG
-
SpeciesH. sapiens (human)
-
Entrez GeneTP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Vector pSpCas9(BB)-2A-Puro (PX459) V2.0 is from Addgene Cat Num: 62988, Zhang Lab
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX459-TP53-exon5 was a gift from John Diffley (Addgene plasmid # 217456 ; http://n2t.net/addgene:217456 ; RRID:Addgene_217456) -
For your References section:
Cyclin E-induced replicative stress drives p53-dependent whole-genome duplication. Zeng J, Hills SA, Ozono E, Diffley JFX. Cell. 2023 Feb 2;186(3):528-542.e14. doi: 10.1016/j.cell.2022.12.036. Epub 2023 Jan 20. 10.1016/j.cell.2022.12.036 PubMed 36681079