PLEKHA3 (FAPP1) g1 lentiCRISPRv2-opti
(Plasmid
#218656)
-
PurposeKnockout vector for human PLEKHA3 (FAPP1)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 218656 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLentiCRISPRv2-Opti (Addgene #163126)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePLEKHA3
-
Alt nameFAPP1
-
gRNA/shRNA sequenceTGTGATGAATGTGTTACACG
-
SpeciesH. sapiens (human)
-
Entrez GenePLEKHA3 (a.k.a. FAPP1)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer hU6-F (5'-GAGGGCCTATTTCCCATGATT-3') (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PLEKHA3 (FAPP1) g1 lentiCRISPRv2-opti was a gift from Wade Harper (Addgene plasmid # 218656 ; http://n2t.net/addgene:218656 ; RRID:Addgene_218656) -
For your References section:
Spatiotemporal proteomic profiling of cellular responses to NLRP3 agonists. Hollingsworth LR, Veeraraghavan P, Paulo JA, Harper JW. bioRxiv 2024.04.19.590338 10.1101/2024.04.19.590338