1
Plasmid 21971: CMV-d2eGFP-20pf
Comments: 

From Supplementary Table 1: "miR-20 perfect CMV sponge and U6 sponge, 2 sites:
CUACCUGCACUAUAAGCACUUUA"

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells. Ebert et al (Nat Methods. 2007 Sep . 4(9):721-6. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 21971" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only
This is commonly requested with