|
Plasmid
21971:
CMV-d2eGFP-20pf
|
Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result. MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells. Ebert et al (Nat Methods. 2007 Sep . 4(9):721-6. PubMed) Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 21971" in your Materials and Methods section. |
From Supplementary Table 1: "miR-20 perfect CMV sponge and U6 sponge, 2 sites:
CUACCUGCACUAUAAGCACUUUA"