pBS4
(Plasmid
#222380)
-
PurposeExpress possum (trvu) CD163 for WPDV entry. trvu_CD163_XM_036735932.1_cod-opt. mNeptune2.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 222380 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAF163
-
Backbone manufacturerAndrew S. Flies Lab
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCD163
-
SpeciesPossum (common brushtail, Trichosurus vulpecula)
- Promoter EF1a
-
Tag
/ Fusion Protein
- TEV-6xHis-mNeptune (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcctcagacagtggttcaaag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid generated by Gibson assembly using NotI and SmaI sites.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBS4 was a gift from Andrew S. Flies (Addgene plasmid # 222380)