1
Plasmid 22506: pSicoR (Puro) NEMO shRNA2
  • NEMO shRNA2

  • NEMO

  • M. musculus (mouse)

  • Ikbkg (RP23-15J3.1, 1110037D23Rik, AI848108, AI851264, AW124339, IKK[g], NEMO)

  • pSicoR PGK puro
    (Search Vector Database)

  • Available at Addgene (#12084)

  • Mammalian Expression, Lentiviral, RNAi, Cre/Lox

  • 7700

  • mU6-F List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • High Copy

  • Puromycin

  • View sequences (1)
  • Tyler Jacks

  • MTA

Comments: 

Mouse NEMO shRNA2 in pSicoReverse (Puromycin)
forward oligo:
TGGACAAGGCCTCTGTGAAATTCAAGAGATTTCACAGAGGCCTTGTCCTTTTTTC
reverse oligo :
TCGAGAAAAAAGGACAAGGCCTCTGTGAAATCTCTTGAATTTCACAGAGGCCTTGTCCA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 22506" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only