p61.pA.mHEL.mCMV.hPGK.CD63GFP.wpre
(Plasmid
#225211)
-
PurposeHEL-H2Kb(TM) in p7; express a membrane-bound hen lysozyme(mHEL)
-
Depositing Lab
-
Depositing OrganizationOregon Health & Science University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225211 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonep7.NGFR.mCMV.hPGK.CD63GFP.wpre
-
Backbone manufacturerPucci Lab
- Total vector size (bp) 9801
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHen Egg lysozyme (Lyz) and H2Kb(TM)
-
Alt nameHen Egg LYSOZYME
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)732
-
GenBank IDlysozyme: NM_205281.2 H2KB: NM_001001892.3
-
Entrez GeneLYZ (a.k.a. LYZC, dystrophin)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site AfeI (unknown if destroyed)
- 5′ sequencing primer CACGAATGCCACAACTGCTC
- 3′ sequencing primer CTGCCCTCGGGAAGGTATTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://ssrn.com/abstract=4912248 for preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p61.pA.mHEL.mCMV.hPGK.CD63GFP.wpre was a gift from Ferdinando Pucci (Addgene plasmid # 225211)