Skip to main content

p61.pA.mHEL.mCMV.hPGK.CD63GFP.wpre
(Plasmid #225211)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 225211 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    p7.NGFR.mCMV.hPGK.CD63GFP.wpre
  • Backbone manufacturer
    Pucci Lab
  • Total vector size (bp) 9801
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Hen Egg lysozyme (Lyz) and H2Kb(TM)
  • Alt name
    Hen Egg LYSOZYME
  • Species
    G. gallus (chicken)
  • Insert Size (bp)
    732
  • GenBank ID
    lysozyme: NM_205281.2 H2KB: NM_001001892.3
  • Entrez Gene
    LYZ (a.k.a. LYZC, dystrophin)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site AfeI (unknown if destroyed)
  • 5′ sequencing primer CACGAATGCCACAACTGCTC
  • 3′ sequencing primer CTGCCCTCGGGAAGGTATTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://ssrn.com/abstract=4912248 for preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p61.pA.mHEL.mCMV.hPGK.CD63GFP.wpre was a gift from Ferdinando Pucci (Addgene plasmid # 225211)