Skip to main content

pETcon-pGAL1-Aga2-α-Synuclein-c_myc
(Plasmid #225222)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 225222 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pETcon(-)
  • Backbone size w/o insert (bp) 5740
  • Total vector size (bp) 6559
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    α-Synuclein
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    420
  • GenBank ID
    6622
  • Entrez Gene
    SNCA (a.k.a. NACP, PARK1, PARK4, PD1)
  • Promoter GAL1
  • Tags / Fusion Proteins
    • c-myc Tag (N terminal on insert)
    • GS linker (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AATATACCTCTATACTTTAACGTC
  • 3′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Aga2
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    261
  • GenBank ID
    852851
  • Entrez Gene
    AGA2 (a.k.a. YGL032C)
  • Promoter GAL1
  • Tags / Fusion Proteins
    • GS linker (N terminal on insert)
    • HA Tag (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AATATACCTCTATACTTTAACGTC
  • 3′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pETcon-pGAL1-Aga2-α-Synuclein-c_myc was a gift from Urartu Seker (Addgene plasmid # 225222 ; http://n2t.net/addgene:225222 ; RRID:Addgene_225222)
  • For your References section:

    Synergistic Screening of Peptide-Based Biotechnological Drug Candidates for Neurodegenerative Diseases Using Yeast Display and Phage Display. Ozcelik CE, Begli O, Hincer A, Ahan RE, Kesici MS, Oguz O, Kasirga TS, Ozcubukcu S, Seker UOS. ACS Chem Neurosci. 2023 Oct 4;14(19):3609-3621. doi: 10.1021/acschemneuro.3c00248. Epub 2023 Aug 28. 10.1021/acschemneuro.3c00248 PubMed 37638647