pAAV-ACTSTar-O2-cjGnat2-g1
(Plasmid
#225362)
-
PurposeFor integrating Cre into the 3' UTR of marmoset GNAT2 gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225362 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV, Cre/Lox, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGNAT2
-
gRNA/shRNA sequencecttatacctgaggaatggtg
-
SpeciesCallithrix jacchus
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SapI (destroyed during cloning)
- 3′ cloning site SapI (destroyed during cloning)
- 5′ sequencing primer gactatcatatgcttaccgt
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-ACTSTar-O2-cjGnat2-g1 was a gift from Baisong Lu (Addgene plasmid # 225362)