1
Plasmid 22612: Flag-HA-GFP
  • GFP

  • green fluorescent protein

  • GFp

  • HA

  • N terminal on backbone

  • FLAG

  • N terminal on backbone

  • None

  • pDEST_LTR_N_FLAG_HA_IRES_puro
    (Search Vector Database)

  • Harper_Lab

  • Mammalian Expression, Retroviral

  • 6521

  • Gateway Cloning

  • GATEWAY_LR

  • Unknown

  • GATEWAY_LR

  • Unknown

  • CAGCCCTCACTCCTTCTCTAGG List of Sequencing Primers

  • CAAGCGGCTTCGGCCAGTAAC

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Puromycin

  • View sequences (1)
  • Wade Harper

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Defining the human deubiquitinating enzyme interaction landscape. Sowa et al (Cell. 2009 Jul 23. 138(2):389-403. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 22612" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only