1
Plasmid 22819: pBTB-3
  • None

  • pBTB-3
    (Search Vector Database)

  • Bacterial Expression

  • 3586

  • XbaI

  • Unknown

  • EcoRV

  • Unknown

  • tctccatacccgtttttttg List of Sequencing Primers

  • Chloramphenicol

  • DH5alpha

  • 37

  • Unknown

  • View sequences (2)
  • Ryan Gill

  • MTA

Comments: 

Addgene's QC sequence shows a 4bp gap with the depositor's provided sequence. The lab does not believe this affects the plasmid activity.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Broad host range vectors for stable genomic library construction. Lynch et al (Biotechnol Bioeng. 2006 May 5. 94(1):151-8. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 22819" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only