pMSCV-IRES-Thy1.1 HLAA2 CAR
(Plasmid
#233472)
-
PurposeA retroviral vector expressing thy1.1 as a marker gene and a second generation HLA-A2 CAR with a myc tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 233472 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMSCV-IRES
-
Backbone manufactureraddgene
- Backbone size w/o insert (bp) 5100
- Total vector size (bp) 7863
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameHLA-A2 CAR
-
SpeciesSynthetic
-
Insert Size (bp)1614
- Promoter 5' LTR
-
Tag
/ Fusion Protein
- myc
Cloning Information for Gene/Insert 1
- Cloning method Gene Synthesis
- 5′ sequencing primer ttgtacaccctaagcctccg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameThy1.1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)489
-
Entrez GeneThy1 (a.k.a. CD90, T25, Thy-1, Thy-1.2, Thy1.1, Thy1.2)
- Promoter IRES
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer CAACGTCTGTAGCGACCCTT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The HLA-A2 CAR was generated with optimised coding sequence of the variable regions of the Ig heavy and light chains from the anti–HLA-A2 BB7.2 hybridoma (ATCC). The resulting scFv was fused to a Myc epitope tag in the extracellular region to enable cell-surface detection by flow cytometry, a stalk region from mouse CD8α, the transmembrane and intracellular domains of mouse CD28, and mouse CD3ζ.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-IRES-Thy1.1 HLAA2 CAR was a gift from Megan Levings (Addgene plasmid # 233472) -
For your References section:
Short Report: CAR Tregs mediate linked suppression and infectious tolerance in islet transplantation. Wardell CM, Fung VCW, Chen E, Haque M, Gillies J, Spanier JA, Mojibian M, Fife BT, Levings MK. bioRxiv [Preprint]. 2024 Apr 10:2024.04.06.588414. doi: 10.1101/2024.04.06.588414. 10.1101/2024.04.06.588414 PubMed 38645184