UPA-DD w/o microexon
(Plasmid
#238352)
-
PurposeOverexpression of mouse ANK3 UPA-DD w/o microexon E35a with N terminal flag tag
-
Depositing Lab
-
Depositing OrganizationColumbia University
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 238352 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCAGGS
-
Vector typeMammalian Expression ; TOPO TA vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMicroexon E35a
-
SpeciesM. musculus (mouse)
- Promoter pCAGGS
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Microexon E35a sequence: gagacagagtcagatcaagatgatgag
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
UPA-DD w/o microexon was a gift from Chaolin Zhang (Addgene plasmid # 238352)