Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

E pCMV-CFPLoxP-YFPatt
(Plasmid #24509)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 24509 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMV
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6724
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Kanamycin, 25 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    ccdB resistance E. Coli like Invitrogen’s One Shot® ccdB Survival™-T1R Chemically Competent Cells
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ECFP, EYFP
  • Alt name
    CFP, YFP
  • Species
    Vibrio fischeri
  • Insert Size (bp)
    757
  • GenBank ID
    P21578
  • Tags / Fusion Proteins
    • ECFP (C terminal on backbone)
    • EYFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site clonase (destroyed during cloning)
  • 3′ cloning site recombinase (destroyed during cloning)
  • 5′ sequencing primer E LoxP-Rcmb GGCCTCGTACTACGCCTATT
  • 3′ sequencing primer TCCGGATGAGCATTCATCAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    1. He, L. et al. Flow cytometric measurement of fluorescence (Forster) resonance energy transfer from cyan fluorescent protein to yellow fluorescent protein using single-laser excitation at 458 nm. Cytometry A. 53, 39-54 (2003).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: This plasmid has been partially sequenced. Due to the presence of repeated features in the plasmid that prohibit thorough sequencing, the provided sequence should be considered theoretical and could contain errors.

Please refer to Lu, Jian-Ping, Beatty, Laura, and Pinthus, Jehonathan . Dual expression recombinase based (DERB) single vector system for high throughput screening and verification of protein interactions in living cells. Available from Nature Precedings

https://www.nature.com/articles/npre.2008.1550.2

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    E pCMV-CFPLoxP-YFPatt was a gift from Jehonathan Pinthus (Addgene plasmid # 24509 ; http://n2t.net/addgene:24509 ; RRID:Addgene_24509)
  • For your References section:

    Dual expression recombinase based (DERB) single vector system for high throughput screening and verification of protein interactions in living cells. Lu J, Beatty L, Pinthus J. Nat Prec (2008). 10.1038/npre.2008.1550.1