1
Plasmid 24575: pFloxin-IRES-Ofd1-Myc-A80T
  • Ofd1

  • 3087

  • M. musculus (mouse)

  • NM_177429

  • Ofd1 (ORF2, Cxorf5, DXGgc7e)

  • Myc

  • C terminal on insert

  • Alanine 80 changed to threonine (codon GCA to ACA)

  • pBluescript
    (Search Vector Database)

  • Mouse Targeting, Cre/Lox

  • 4873

  • tcggtgcacatgctttacat List of Sequencing Primers

  • Ampicillin

  • Stbl2

  • 37

  • Stbl2 (Invitrogen) or other RecA- strain 37 degrees in LB media

  • Low Copy

  • View sequences (3)
  • View map

  • Jeremy Reiter

  • MTA

Comments: 

Mutation reported in:

Four novel mutations in the OFD1 (Cxorf5) gene in Finnish patients with oral-facial-digital syndrome 1.

Rakkolainen A, Ala-Mello S, Kristo P, Orpana A, Järvelä I.

J Med Genet. 2002 Apr;39(4):292-6. No abstract available. PMID: 11950863

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Ofd1, a human disease gene, regulates the length and distal structure of centrioles. Singla et al (Dev Cell. 2010 Mar 16. 18(3):410-24. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 24575" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with