1
Plasmid 24578: pFloxin-Ofd1-Myc-KDD359-361FSY
  • Ofd1

  • 2781

  • M. musculus (mouse)

  • NM_177429

  • Ofd1 (ORF2, Cxorf5, DXGgc7e)

  • Myc

  • C terminal on insert

  • Lysine-Aspartate-Aspartate 359-361 changed to Phenylalanine-Serine-Tyrosine (codons AAG-GAT-GAC changed to TTT-TTC-TAC) Includes exons 4-23 only

  • pBluescript
    (Search Vector Database)

  • Mouse Targeting, Cre/Lox

  • 4021

  • aacctctgccctttctcctc List of Sequencing Primers

  • Ampicillin

  • Stbl2

  • 37

  • Stbl2 (Invitrogen) or other RecA- strain 37 degrees in LB media

  • Low Copy

  • View sequences (3)
  • View map

  • Jeremy Reiter

  • MTA

Comments: 

Mutation reported in:

Identification of the gene for oral-facial-digital type I syndrome.

Ferrante MI, Giorgio G, Feather SA, Bulfone A, Wright V, Ghiani M, Selicorni A, Gammaro L, Scolari F, Woolf AS, Sylvie O, Bernard L, Malcolm S, Winter R, Ballabio A, Franco B.

Am J Hum Genet. 2001 Mar;68(3):569-76. Epub 2001 Feb 13.PMID: 11179005

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Ofd1, a human disease gene, regulates the length and distal structure of centrioles. Singla et al (Dev Cell. 2010 Mar 16. 18(3):410-24. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 24578" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with