Skip to main content

LMPd-Amt shUgp2
(Plasmid #246074)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 246074 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLMPd-Amt
  • Backbone manufacturer
    Chen et al., 2014 (PMID: 25148027)
  • Vector type
    Retroviral
  • Selectable markers
    mAmetrine1.1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ugp2 shRNA
  • gRNA/shRNA sequence
    GGGCTAAAGAGTTTCTTATAATTACATCTGTGGCTTCACTAATTATAAGAAACTCTTTAGCCT
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Ugp2 (a.k.a. MGC38262)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LMPd-Amt shUgp2 was a gift from Russell Jones (Addgene plasmid # 246074 ; http://n2t.net/addgene:246074 ; RRID:Addgene_246074)
  • For your References section:

    Glucose-dependent glycosphingolipid biosynthesis fuels CD8(+) T cell function and tumor control. Longo J, DeCamp LM, Oswald BM, Teis R, Reyes-Oliveras A, Dahabieh MS, Ellis AE, Vincent MP, Damico H, Gallik KL, Foy NM, Compton SE, Capan CD, Williams KS, Esquibel CR, Madaj ZB, Lee H, Roy DG, Krawczyk CM, Haab BB, Sheldon RD, Jones RG. Cell Metab. 2025 Jul 30:S1550-4131(25)00333-X. doi: 10.1016/j.cmet.2025.07.006. 10.1016/j.cmet.2025.07.006 PubMed 40769148