LMPd-Amt shUgp2
(Plasmid
#246074)
-
PurposeRetroviral vector with Ametrine marker for expressing shRNA with an "UltramiR" microRNA scaffold
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246074 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLMPd-Amt
-
Backbone manufacturerChen et al., 2014 (PMID: 25148027)
-
Vector typeRetroviral
-
Selectable markersmAmetrine1.1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUgp2 shRNA
-
gRNA/shRNA sequenceGGGCTAAAGAGTTTCTTATAATTACATCTGTGGCTTCACTAATTATAAGAAACTCTTTAGCCT
-
SpeciesM. musculus (mouse)
-
Entrez GeneUgp2 (a.k.a. MGC38262)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LMPd-Amt shUgp2 was a gift from Russell Jones (Addgene plasmid # 246074 ; http://n2t.net/addgene:246074 ; RRID:Addgene_246074) -
For your References section:
Glucose-dependent glycosphingolipid biosynthesis fuels CD8(+) T cell function and tumor control. Longo J, DeCamp LM, Oswald BM, Teis R, Reyes-Oliveras A, Dahabieh MS, Ellis AE, Vincent MP, Damico H, Gallik KL, Foy NM, Compton SE, Capan CD, Williams KS, Esquibel CR, Madaj ZB, Lee H, Roy DG, Krawczyk CM, Haab BB, Sheldon RD, Jones RG. Cell Metab. 2025 Jul 30:S1550-4131(25)00333-X. doi: 10.1016/j.cmet.2025.07.006. 10.1016/j.cmet.2025.07.006 PubMed 40769148