pGGD-AtUBQ10 Promoter-scFV-sfGFP
(Plasmid
#246803)
-
PurposeA GreenGate entry vector containing scFV-sfGFP fusion gene drived by an AtUBQ10 Promoter
-
Depositing Lab
-
Depositing OrganizationInstitute of Genetics and Developmental Biology, Chinese Academy of Sciences
Located in China -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246803 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepGGD000
- Backbone size w/o insert (bp) 2686
-
Vector typeGreenGate cloning entry vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAtUBQ10 Promoter-scFV-sfGFP
-
SpeciesA. thaliana (mustard weed), Synthetic
-
Insert Size (bp)3046
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (not destroyed)
- 3′ cloning site BsaI (not destroyed)
- 5′ sequencing primer atgtgagttagctcactcattaggcac
- 3′ sequencing primer gcaaggcgattaagttgggtaacg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGGD-AtUBQ10 Promoter-scFV-sfGFP was a gift from Danhua Jiang (Addgene plasmid # 246803 ; http://n2t.net/addgene:246803 ; RRID:Addgene_246803)