pJH5155
(Plasmid
#253948)
-
PurposeP C54F6.5 C54F6.5 SL2-NLS::mNeptune C54F6.5 3' UTR C54F6.5 transcriptional report
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253948 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepBSK
- Backbone size w/o insert (bp) 5900
- Total vector size (bp) 7092
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSL2 NLS mNeptune
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)1192
- Promoter P C54F6.5
-
Tag
/ Fusion Protein
- RFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (destroyed during cloning)
- 3′ cloning site DraIII (not destroyed)
- 5′ sequencing primer CCCgctgtctcatcctacttt
- 3′ sequencing primer CTCGTGCTGCTCGACGTAGGTCTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit for https://www.biorxiv.org/content/10.1101/2021.09.21.461278v4 bioRxiv preprint.
There is a single nt discrepancy in Pgpc-1. This does not affect the plasmid's function.
The Addgene sequence result finds a 1bp indel at the 3' end of the ORF containing mCardinal that causes a premature stop codon. The indel does not affect the expression and localization of the NLS::mNeptune. The protein in the plasmid expresses a few amino acids past the final Lysine of mNeptune and therefore, the premature stop does not truncate any functional part of the fluorescent protein. We observed bright nuclear RFP signal with this plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJH5155 was a gift from Mei Zhen (Addgene plasmid # 253948 ; http://n2t.net/addgene:253948 ; RRID:Addgene_253948) -
For your References section:
Three muscle-specific DAF-16/FOXO transcriptional targets activated by reduced insulin/IGF-1 signaling. Wu S, Gao J, Li Y, Roy C, Wang Y, Mulcahy B, Li W, Ravivarma S, Calarco J, Hung W, Zhen M. G3 (Bethesda). 2026 Apr 1;16(4):jkag030. doi: 10.1093/g3journal/jkag030. 10.1093/g3journal/jkag030 PubMed 41773048