Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMBD-Gate6
(Plasmid #25962)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 25962 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBIND
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 6360
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    Strain (ccdB Survival Strain): F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araΔ139 Δ(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG fhuA::IS2 ; Growth condition: 37°C
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    None
  • Insert Size (bp)
    1713
  • Tag / Fusion Protein
    • GAL4 Fusion Protein (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer TGCCGTCACAGATAGATTGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMBD-Gate6 was a gift from Kamil Onder (Addgene plasmid # 25962 ; http://n2t.net/addgene:25962 ; RRID:Addgene_25962)
  • For your References section:

    Coupled Yeast 2-Hybrid-Mammalian 2-Hybrid Reading-Frame-Independent and Site-Specific Recombinational Cloning Vector System. Maier CJ, Maier RH, Hintner H, Bauer JW, Onder K. Assay Drug Dev Technol. 2010 Jun 1. ():. 10.1089/adt.2009.0266 PubMed 20515414