Skip to main content
Addgene
Open Menu

pGEX-GST-beta-arrestin1-393 (cysteine-free)
(Plasmid #259691)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 259691 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pGEX-4T
  • Total vector size (bp) 6231
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rat beta-arrestin1-393 (cysteine-free; C59A, C125S, C140I, C150V, C242V, C251V, and C269S)
  • Alt name
    ARRB2
  • Species
    R. norvegicus (rat)
  • Mutation
    C59A, C125S, C140I, C150V, C242V, C251V, and C269S; truncated at residue 393
  • Entrez Gene
    Arrb2 (a.k.a. BARRES)
  • Promoter tac
  • Tag / Fusion Protein
    • GST (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX-GST-beta-arrestin1-393 (cysteine-free) was a gift from Laura Wingler (Addgene plasmid # 259691 ; http://n2t.net/addgene:259691 ; RRID:Addgene_259691)

  • For your References section:

    Angiotensin receptor conformations stabilized by biased ligands differentially modulate beta-arrestin interactions. Elgeti M, Belyaeva J, Helabad MB, Staus DP, Wingler LM. J Biol Chem. 2026 Feb;302(2):111117. doi: 10.1016/j.jbc.2025.111117. Epub 2025 Dec 29. 10.1016/j.jbc.2025.111117 PubMed 41475549
Related items: