pMLLKA-J72019
(Plasmid #26010)

Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pMLL-KA
  • Backbone size w/o insert (bp) 2646
  • Vector type
    Synthetic Biology ; 2ab assembly vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Other
  • Growth instructions
    Provided in a pir+ strain. Grow at 37C
  • Copy number
    Low Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    N terminal Flag tag with RBS
  • Alt name
    Bmll54
  • Alt name
    J72019
  • Insert Size (bp)
    72

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer gtatcacgaggcagaatttcag
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Note that this plasmid needs to be grown in both Kanamycin and Ampicillin

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMLLKA-J72019 was a gift from Christopher Anderson (Addgene plasmid # 26010)