Modified Shipping Schedule: Addgene will be closed November 26th & 27th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 23 - 27. If you have any questions, please contact us at

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

(Plasmid #26010)

Add to Cart
Available to Academic and Nonprofits Only


  • Vector backbone
  • Backbone size w/o insert (bp) 2646
  • Vector type
    Synthetic Biology ; 2ab assembly vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Provided in a pir+ strain. Grow at 37C
  • Copy number
    Low Copy

Sequence Information


  • Gene/Insert name
    N terminal Flag tag with RBS
  • Alt name
  • Alt name
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer gtatcacgaggcagaatttcag
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Note that this plasmid needs to be grown in both Kanamycin and Ampicillin

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMLLKA-J72019 was a gift from Christopher Anderson (Addgene plasmid # 26010)