1
Plasmid 26010: pMLLKA-J72019
  • N terminal Flag tag with RBS

  • Bmll54

  • J72019

  • 72

  • pMLL-KA
    (Search Vector Database)

  • 2ab assembly vector

  • 2646

  • BglII

  • No

  • BamHI

  • No

  • gtatcacgaggcagaatttcag List of Sequencing Primers

  • Ampicillin and Kanamycin

  • Other

  • 37

  • Provided in a pir+ strain. Grow at 37C

  • Low Copy

  • View sequences (3)
  • Christopher Anderson

  • MTA

Comments: 

Note that this plasmid needs to be grown in both Kanamycin and Ampicillin

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26010" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with