1
Plasmid 26010: pMLLKA-J72019
  • N terminal Flag tag with RBS

  • Bmll54

  • J72019

  • 72

  • pMLL-KA
    (Search Vector Database)

  • SynBio ; 2ab assembly vector

  • 2646

  • BglII

  • No

  • BamHI

  • No

  • gtatcacgaggcagaatttcag List of Sequencing Primers

  • Ampicillin and Kanamycin

  • Other

  • 37

  • Provided in a pir+ strain. Grow at 37C

  • Low Copy

  • View sequences (3)
  • Christopher Anderson

  • UBMTA

Comments: 

Note that this plasmid needs to be grown in both Kanamycin and Ampicillin

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26010" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only
This is commonly requested with