Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #26072)


Item Catalog # Description Quantity Price (USD)
Plasmid 26072 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • GenBank ID

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site HincII (unknown if destroyed)
  • 5′ sequencing primer acctgacgctttttatcgca
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBMTBX-1 was a gift from Ryan Gill (Addgene plasmid # 26072 ; ; RRID:Addgene_26072)
  • For your References section:

    Broad-host-range vectors for protein expression across gram negative hosts. Prior JE, Lynch MD, Gill RT. Biotechnol Bioeng. 2010 Jun 1. 106(2):326-32. 10.1002/bit.22695 PubMed 20148414