pPR244-C3H-zfn-1
(Plasmid
#26141)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26141 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepPR244
- Backbone size w/o insert (bp) 2650
-
Vector typeRNAi
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsHT115(DE3)
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSmed-C3H-zfn-1
-
Alt nameC3H-zfn-1
-
SpeciesSchmidtea mediterranea
-
Insert Size (bp)1623
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CCTCGAGGTCGACGGTATC
- 3′ sequencing primer AACAAAAGCTGGAGCTCCAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPR244-C3H-zfn-1 was a gift from Phillip Newmark (Addgene plasmid # 26141 ; http://n2t.net/addgene:26141 ; RRID:Addgene_26141) -
For your References section:
A functional genomic screen in planarians identifies novel regulators of germ cell development. Wang Y, Stary JM, Wilhelm JE, Newmark PA. Genes Dev. 2010 Sep 15. 24(18):2081-92. 10.1101/gad.1951010 PubMed 20844018