-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26155 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMV306
- Backbone size w/o insert (bp) 3938
-
Vector typeMycobacteria integrating vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namehsp60 promoter
-
SpeciesMycobacterium bovis BCG
-
Insert Size (bp)435
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer aaccgtattaccgcctttga (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe hsp60 promoter was obtained from pSMT3
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There are a few sequence discrepancies between author sequence and Addgene quality control sequence for the hsp promoter. The hsp promoter sequence was taken from the pSMT3 vector and is theoretical sequence. These differences do not affect function.
Garbe, T.R., et al., Transformation of mycobacterial species using hygromycin resistance as selectable marker. Microbiology, 1994. 140 ( Pt 1): p. 133-8.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMV306hsp was a gift from Brian Robertson & Siouxsie Wiles (Addgene plasmid # 26155 ; http://n2t.net/addgene:26155 ; RRID:Addgene_26155) -
For your References section:
Optimisation of bioluminescent reporters for use with mycobacteria. Andreu N, Zelmer A, Fletcher T, Elkington PT, Ward TH, Ripoll J, Parish T, Bancroft GJ, Schaible U, Robertson BD, Wiles S. PLoS One. 2010 May 24;5(5):e10777. 10.1371/journal.pone.0010777 PubMed 20520722