1
Plasmid 26181: pMLLCK-J72036
  • C terminal VSV tag

  • Bmll66

  • J72036

  • 42

  • pMLL-CK
    (Search Vector Database)

  • 2ab assembly vector

  • 2852

  • BglII

  • No

  • BamHI

  • No

  • gtatcacgaggcagaatttcag List of Sequencing Primers

  • Chloramphenicol AND Kanamycin

  • Other

  • 37

  • Provided in a pir+ strain. Grow at 37C

  • Low Copy

  • View sequences (2)
  • Christopher Anderson

  • MTA

Comments: 

Note that this plasmid must be grown in both Chloramphenicol and Kanamycin

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26181" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with