Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Psicheck2 Sox4 mut 3'UTR oligo
(Plasmid #26988)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 26988 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6300
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Sox4 mut UTR oligo
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    bp 449-509 of SOX4 3'UTR; mut @ bp 483
  • Entrez Gene
    SOX4 (a.k.a. CSS10, EVI16)
  • Tag / Fusion Protein
    • Renilla Luciferase (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer Rluc-F
  • 3′ sequencing primer psiCHECK2-R (CGAGGTCCGAAGACTCATTT)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

TTGCTTCTT => GGGCTGAGG, the mutation is in miR33 target sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Psicheck2 Sox4 mut 3'UTR oligo was a gift from Joan Massague (Addgene plasmid # 26988 ; ; RRID:Addgene_26988)
  • For your References section:

    Endogenous human microRNAs that suppress breast cancer metastasis. Tavazoie SF, Alarcon C, Oskarsson T, Padua D, Wang Q, Bos PD, Gerald WL, Massague J. Nature. 2008 Jan 10. 451(7175):147-52. 10.1038/nature06487 PubMed 18185580