1
Plasmid 27967: monomer-NG
  • TAL-monomer-NG

  • monomer-NG

  • 102

  • Xanthomonas

  • pJ201
    (Search Vector Database)

  • Bacterial Expression

  • 2672

  • GATGGTAGTGTGGGGACTCC List of Sequencing Primers

  • Kanamycin

  • DH5alpha

  • 37

  • High Copy

  • DNA 2.0

  • View sequences (2)
  • Feng Zhang

  • UBMTA

Comments: 

Please visit www.taleffectors.com for detailed protocols and plasmid maps.

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. Zhang et al (Nat Biotechnol. 2011 Jan 19. ():. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 27967" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only